A hospital notices that several patients have the same bacterial urinary tract infection caused by E. coliE. coli . All of these patients have an indwelling urinary catheter. Bactrim is usually the standard drug of choice, however this bacteria has become resistant to this antibiotic. 1) What is the main cellular target of Bactrim? Explain. Cell wall synthesis Cell membrane function DNA/RNA synthesis Protein synthesis Inhibition of general metabolic pathway not used by us Inhibition of pathogen’s attachment to or recognition of host

A hospital notices that several patients have the same bacterial urinary tract infection caused by E. coliE. coli

. All of these patients have an indwelling urinary catheter. Bactrim is usually the standard drug of choice, however this  bacteria has become resistant to this antibiotic.

1) What is the main cellular target of Bactrim? Explain.

  1. Cell wall synthesis
  2. Cell membrane function
  3. DNA/RNA synthesis
  4. Protein synthesis
  5. Inhibition of general metabolic pathway not used by us
  6. Inhibition of pathogen’s attachment to or recognition of host
 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"

Explain the following in plain English using what you know.the change in chromosome number in wheat, correlate opioid peptides and wheat and its effects on your body, the difference in the glycemic index between sugar and bread and what plants innately posses to “protect” themselves

Explain the following in plain English using what you know.the change in chromosome number in wheat,

correlate opioid peptides and wheat and its effects on your body,

the difference in the glycemic index between sugar and bread

and what plants innately posses to “protect” themselves

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"

What would be the anticodon2. Use the following DNA template strand to determine the mRNA sequence:  for Tyrosine

What would be the anticodon2. Use the following DNA template strand to determine the mRNA sequence:

for Tyrosine

3′- CGTACGCTAACGGATGTACT -5′

 

3. What amino acid chain will be produced from this “gene”

4. What type of point mutation has occurred if the second G is mutated to an adenine (A), resulting in the following change to the gene: CGTACACTAACGGATGTACT?

 

5. If the RNA polymerase makes an error during transcription, will this error be inherited by the offspring? Explain.

 

6. True or False. All mutations are detrimental. Explain.

7. What type of genetic recombination has occurred if this gene is transferred from the donor cell to the recipient cell via a bacteriophage?

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"

what is the origin and insertion of the biceps brachii shorthand and longhead?

what is the origin and insertion of the biceps brachii shorthand and longhead?

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"

GameDog is a small start-up company that that develops video games. An independent marketing research firm – using a combination of demographic, behavioristic, and psychographic variables – has broken the overall video game market into three segments.

GameDog is a small start-up company that that develops video games.

An independent marketing research firm – using a combination of demographic, behavioristic, and psychographic variables – has broken the overall video game market into three segments. Because GameDog lacks the financial resources to compete in all three segments, management must decide which segment it will pursue as its sole target market. Accordingly, GameDog’s top management has asked you to list and explain the criteria it should take into consideration to assess the attractiveness of each market segment. In doing so, explain the relevance of each criteria.
Please note that you are not being asked to speculate on or recommend a particular video game segment. Instead, you are being asked to describe the criteria for assessing market segments, in general, and choosing a target market.

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"

The movie 12 Angry Men by Reginald Rose is about a jury discussing a murder case. Below is a small section of the screenplay from early in the film: FOREMAN:

The movie 12 Angry Men by Reginald Rose is about a jury discussing

a murder case. Below is a small section of the screenplay from early in the film:
FOREMAN:
We have a first-degree murder charge here and if we vote the accused guilty we’ve got to send him to the chair. That’s mandatory.

FOREMAN:
Anybody doesn’t want to vote? [He looks around the table. There is no answer.] Okay, then just remember that this has to be 12 to nothing either way. That’s the law. Ok, are we ready? All those voting guilty raise your hands.
[Seven or eight hands go up immediately. Several others go up more slowly. Everyone looks around the table. There are two hands not raised, NO. 9’s and NO. 8’s. NO. 9’s hand goes up slowly now as the foreman counts.]
FOREMAN:
Nine… ten … eleven… That’s eleven for guilty. Okay. Not guilty? [NO. 8’s hand is raised.] One. Right. Okay. Eleven to one, guilty. Now we know where we are.
NO. 3:
[sarcastically] Somebody’s in left field. [To NO. 8] You think he’s not guilty?
NO. 8:
[quietly]. I don’t know.

NO. 10:
[to NO. 8]. Well, do you believe his story?
NO. 8:
I don’t know whether I believe it or not. Maybe I don’t.
With this segment of the transcript in mind, please answer the following questions:
(1) What form of social influence did the foreman use in the process of making a decision? Name it and explain specifically what action was taken to make use of that form of social influence.
(2) What decision rule is in place? Name it and explain specifically how that decision rule influences the likelihood of the group changing its perspective or considering multiple perspectives in its decision-making process.
(3) Explain the value of Juror Number 8 to the group changing its perspective or considering multiple perspectives in its decision-making process.

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"

Dissenters need to speak up at the beginning of team meetings because after a majority forms a shared perspective, providing alternative views is just a pointless waste of time. True or False

Dissenters need to speak up at the beginning of team meetings because

after a majority forms a shared perspective, providing alternative views is just a pointless waste of time.
True or False

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"

Dissenters need to speak up at the beginning of team meetings because after a majority forms a shared perspective, providing alternative views is just a pointless waste of time. True or False

Dissenters need to speak up at the beginning of team meetings because

after a majority forms a shared perspective, providing alternative views is just a pointless waste of time.
True or False

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"

De las palabras de origen árabe dadas, ¿cuáles se usan también en inglés? 7. ¿Puede mencionar algunas palabras del inglés que provengan del latín? These are from the la lengua que heredamos 7th edition

De las palabras de origen árabe dadas, ¿cuáles se usan también en inglés?

7. ¿Puede mencionar algunas palabras del inglés que provengan del latín?

These are from the la lengua que heredamos 7th edition

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"

You have a bucket with 32 fair coins, i.e., if flipped, each coin has a 50% chance of coming up heads and 50% chance of coming up tales. You add an extra coin to the bucket, but this coin has heads in both sides.

You have a bucket with 32 fair coins, i.e., if flipped, each coin

has a 50% chance of coming up heads and 50% chance of coming up tales. You add an extra coin to the bucket, but this coin has heads in both sides.
You shake the bucket and pick one coin at random. What is the probability that you selected the double-headed coin?

0

1/33

1

1/32

1/2

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"