What would be the anticodon2. Use the following DNA template strand to determine the mRNA sequence:  for Tyrosine

What would be the anticodon2. Use the following DNA template strand to determine the mRNA sequence:

for Tyrosine

3′- CGTACGCTAACGGATGTACT -5′

 

3. What amino acid chain will be produced from this “gene”

4. What type of point mutation has occurred if the second G is mutated to an adenine (A), resulting in the following change to the gene: CGTACACTAACGGATGTACT?

 

5. If the RNA polymerase makes an error during transcription, will this error be inherited by the offspring? Explain.

 

6. True or False. All mutations are detrimental. Explain.

7. What type of genetic recombination has occurred if this gene is transferred from the donor cell to the recipient cell via a bacteriophage?

 
"Looking for a Similar Assignment? Order now and Get 10% Discount! Use Code "Newclient"